AN_AmpliconDeepSeq

Detect introduced or expected mutations Discover rare genomic variations with high confidence Introduction Amplicon deep sequencing using next generation sequencing (NGS) technolo - gies has become a powerful tool to study a wide variety of research questions. Typical applications include (i) CRISPR genome editing protocols of eukaryotes, (ii) genome-wide transposon insertion analysis in microorganisms, (iii) human leukocyte antigen (HLA) typing and (iv) screening of specific somatic muta - tions in tumor tissues. Common to all these approaches is that a PCR is used to amplify fragments, which are then sequenced on a single-molecule level. The Two-Step PCR Approach – How it Works The two-step PCR approach combined with Illumina’s dual indexing strategy allows to process up to 384 samples in parallel (see Figure 1 ). The first-step PCR uses primers contain - ing a locus-specific sequence as well as a universal 5’ tail as specified in the Nextera library protocol from Illumina (see Table 1 ). Instead of using only one single forward and reverse primer, some proto - cols make use of up to 3 forward primers that differ in length by adding wobble bases (Ns) between the locus-specific and common 5’ tail. This might be espe - cially useful in high-throughput projects where the sequencing throughput is especially critical and many samples are pooled. However, for most projects the sequencing throughput is high enough by simply using one forward and one reverse primer. If you need further back - ground about this particular topic, please contact us. The resulting PCR amplicons are then used as templates within the second-step PCR for further amplification, but also to include the indexes (barcodes) as well as the Illumina adaptors. The Illumina indexing strategy for the second-step PCR consists of 16 forward primers and 24 reverse primers. The combinatorial use of these primers (16 x 24) defines the maximal number of 384 samples which can be pooled and sequenced on one Illumina MiSeq/NextSeq run. Amplicon Deep Sequencing on the lllumina MiSeq/NextSeq Platform Start of For Read Start of Rev Read First-Step PCR Second-Step PCR i5_S5xy barcode i7_N7xy barcode Figure 1. Overview of the double indexing strategy used in the Illumina two-step protocol. During the Illumina sequencing step the amplified genomic sequence including the specific primers (grey and blue bars) as well as the forward and reverse barcodes (orange bar) are read out. Table 1. 5’ tails used for the first-step PCR. Oligonucleotide sequences © 2007-2013 Illumina, Inc. All rights reserved. Primer Name Sequence (5‘-3‘) 1st_PCR_for TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific sequence] 1st_PCR_rev GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[locus-specific sequence] Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Table 2. Indexed forward primers for the second-step PCR. Oligonucleotide sequences © 2007-2013 Illumina, Inc. All rights reserved. Primer Name Sequence (5‘-3‘)Sequence (5‘-3‘) NGS_i5_S502 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific AATGATACGGCGACCACCGAGATCTACAC CTCTCTAT TCGTCGGCAGCGTC NGS_i5_S503 AATGATACGGCGACCACCGAGATCTACAC TATCCTCT TCGTCGGCAGCGTC Index NameIndex Name TCGTCGGCAG - S502 (set A/B) S503 (set A/B) Index NameIndex Sequence TCGTCGGCAG - CTCTCTAT TATCC TC T NGS_i5_S505 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific AATGATACGGCGACCACCGAGATCTACAC GTAAGGAG TCGTCGGCAGCGTC NGS_i5_S506 AATGATACGGCGACCACCGAGATCTACAC A C T G C ATA TCGTCGGCAGCGTC TCGTCGGCAG - S505 (set A/B) S506 (set A/B) TCGTCGGCAG - GTAAGGAG A C TG C ATA NGS_i5_S507 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific AATGATACGGCGACCACCGAGATCTACAC AAGGAGTA TCGTCGGCAGCGTC NGS_i5_S508 AATGATACGGCGACCACCGAGATCTACAC CTAAGCCT TCGTCGGCAGCGTC TCGTCGGCAG - S507 (set A/B) S508 (set A/B) TCGTCGGCAG - AAGGAGTA CTAAGCCT NGS_i5_S510 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific AATGATACGGCGACCACCGAGATCTACAC CGTCTAAT TCGTCGGCAGCGTC NGS_i5_S511 AATGATACGGCGACCACCGAGATCTACAC TCTCTCCG TCGTCGGCAGCGTC TCGTCGGCAG - S510 (set A/B) S511 (set A/B) TCGTCGGCAG - CGTCTAAT TC TC TCCG NGS_i5_S513 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific AATGATACGGCGACCACCGAGATCTACAC TCGACTAG TCGTCGGCAGCGTC NGS_i5_S515 AATGATACGGCGACCACCGAGATCTACAC TTCTAGCT TCGTCGGCAGCGTC TCGTCGGCAG - S513 (set C/D) S515 (set C/D) TCGTCGGCAG - TCGACTAG TTCTAGCT NGS_i5_S516 AATGATACGGCGACCACCGAGATCTACAC CCTAGAGT TCGTCGGCAGCGTC NGS_i5_S517 AATGATACGGCGACCACCGAGATCTACAC GCGTAAGA TCGTCGGCAGCGTC S516 (set C/D) S517 (set C/D) CCTAGAGT GCGTAAGA NGS_i5_S518 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific AATGATACGGCGACCACCGAGATCTACAC C TAT TA AG TCGTCGGCAGCGTC NGS_i5_S520 AATGATACGGCGACCACCGAGATCTACAC AAGGCTAT TCGTCGGCAGCGTC TCGTCGGCAG - S518 (set C/D) S520 (set C/D) TCGTCGGCAG - C TAT TA A G AAGGCTAT NGS_i5_S521 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific AATGATACGGCGACCACCGAGATCTACAC GAGCCTTA TCGTCGGCAGCGTC NGS_i5_S522 AATGATACGGCGACCACCGAGATCTACAC TTATGCGA TCGTCGGCAGCGTC TCGTCGGCAG - S521 (set C/D) S522 (set C/D) TCGTCGGCAG - GAGCCTTA TTATGCGA Table 3. Indexed reverse primers for the second-step PCR. Oligonucleotide sequences © 2007-2013 Illumina, Inc. All rights reserved. Primer Name Sequence (5‘-3‘)Sequence (5‘-3‘) NGS_i7_N701 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT TCGCCT TA GTCTCGTGGGCTCGG NGS_i7_N702 CAAGCAGAAGACGGCATACGAGAT C TAG TACG GTCTCGTGGGCTCGG Index NameIndex Name TCGTCGGCAG - N701 (set A/C) N702 (set A/C) Index NameIndex Sequence TCGTCGGCAG - TCGCCT TA C TA G TA C G NGS_i7_N703 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT T TCTGCCT GTCTCGTGGGCTCGG NGS_i7_N704 CAAGCAGAAGACGGCATACGAGAT GCTCAGGA GTCTCGTGGGCTCGG TCGTCGGCAG - N703 (set A/C) N704 (set A/C) TCGTCGGCAG - T TC TGCC T GCTCAGGA NGS_i7_N705 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT AGGAGTCC GTCTCGTGGGCTCGG NGS_i7_N706 CAAGCAGAAGACGGCATACGAGAT C AT G C C TA GTCTCGTGGGCTCGG TCGTCGGCAG - N705 (set A/C) N706 (set A/C) TCGTCGGCAG - AGGAGTCC C ATG C C TA NGS_i7_N707 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT GTAGAGAG GTCTCGTGGGCTCGG NGS_i7_N710 CAAGCAGAAGACGGCATACGAGAT CAGCCTCG GTCTCGTGGGCTCGG TCGTCGGCAG - N707 (set A/C) N710 (set A/C) TCGTCGGCAG - GTAGAGAG CAGCCTCG NGS_i7_N711 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT TGCCTCT T GTCTCGTGGGCTCGG NGS_i7_N712 CAAGCAGAAGACGGCATACGAGAT TCCTCTAC GTCTCGTGGGCTCGG TCGTCGGCAG - N711 (set A/C) N712 (set A/C) TCGTCGGCAG - TGCC TC T T TCC TC TAC NGS_i7_N714 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT TCATGAGC GTCTCGTGGGCTCGG NGS_i7_N715 CAAGCAGAAGACGGCATACGAGAT CCTGAGAT GTCTCGTGGGCTCGG TCGTCGGCAG - N714 (set A/C) N715 (set A/C) TCGTCGGCAG - TCATGAGC CCTGAGAT NGS_i7_N716 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT TAGCGAGT GTCTCGTGGGCTCGG NGS_i7_N718 CAAGCAGAAGACGGCATACGAGAT GTAGCTCC GTCTCGTGGGCTCGG TCGTCGGCAG - N716 (set B/D) N718 (set B/D) TCGTCGGCAG - TAGCGAGT GTAGCTCC NGS_i7_N719 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT TAC TACG C GTCTCGTGGGCTCGG NGS_i7_N720 CAAGCAGAAGACGGCATACGAGAT AGGCTCCG GTCTCGTGGGCTCGG TCGTCGGCAG - N719 (set B/D) N720 (set B/D) TCGTCGGCAG - TA C TA C G C AGGCTCCG NGS_i7_N721 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT GCAGCGTA GTCTCGTGGGCTCGG NGS_i7_N722 CAAGCAGAAGACGGCATACGAGAT CTGCGCAT GTCTCGTGGGCTCGG TCGTCGGCAG - N721 (set B/D) N722 (set B/D) TCGTCGGCAG - GCAGCGTA CTGCGCAT NGS_i7_N723 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT GAGCGCTA GTCTCGTGGGCTCGG NGS_i7_N724 CAAGCAGAAGACGGCATACGAGAT CGCTCAGT GTCTCGTGGGCTCGG TCGTCGGCAG - N723 (set B/D) N724 (set B/D) TCGTCGGCAG - GAGCGCTA CGCTCAGT NGS_i7_N726 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT GTCTTAGG GTCTCGTGGGCTCGG NGS_i7_N727 CAAGCAGAAGACGGCATACGAGAT ACTGATCG GTCTCGTGGGCTCGG TCGTCGGCAG - N726 (set B/D) N727 (set B/D) TCGTCGGCAG - GTCTTAGG AC TGATCG NGS_i7_N728 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT TAGCTGCA GTCTCGTGGGCTCGG NGS_i7_N729 CAAGCAGAAGACGGCATACGAGAT GACGTCGA GTCTCGTGGGCTCGG TCGTCGGCAG - N728 (set B/D) N729 (set B/D) TCGTCGGCAG - TAGCTGCA GACGTCGA How to Order the NGS Primers? First, download the specific “OrderForm_ IlluminaAmpliconDeepSeq” from Microsynth’s website (see Amplicon Deep Sequencing within the NGS menu). Next, specify the locus-specific sequences for your first-step PCR primers, and then Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Example of Primer Pipetting Scheme for 96 Samples (8 x 12 indexes) PCR Design Considerations In general, the first-step PCR is a standard PCR using a proofreading polymerase and 5’ tailed PCR primers. The only point to consider is the length (up to 500  bp) of the amplified product including the locus-specific parts of the forward and reverse primers. If the sequence of the entire amplicon is of interest, the Illumina forward and reverse reads may be merged to reconstruct the full length molecule. Single-end run configurations are also possible depending on your specific question. Please contact us to discuss your options. S502 N701 S502 N702 S502 N703 S502 N704 S502 N705 S502 N706 S502 N707 S502 N710 S502 N711 S502 N712 S502 N714 S502 N715 S503 N701 S503 N702 S503 N703 S503 N704 S503 N705 S503 N706 S503 N707 S503 N710 S503 N711 S503 N712 S503 N714 S503 N715 S505 N701 S505 N702 S505 N703 S505 N704 S505 N705 S505 N706 S505 N707 S505 N710 S505 N711 S505 N712 S505 N714 S505 N715 S506 N701 S506 N702 S506 N703 S506 N704 S506 N705 S506 N706 S506 N707 S506 N710 S506 N711 S506 N712 S506 N714 S506 N715 S507 N701 S507 N702 S507 N703 S507 N704 S507 N705 S507 N706 S507 N707 S507 N710 S507 N711 S507 N712 S507 N714 S507 N715 S508 N701 S508 N702 S508 N703 S508 N704 S508 N705 S508 N706 S508 N707 S508 N710 S508 N711 S508 N712 S508 N714 S508 N715 S510 N701 S510 N702 S510 N703 S510 N704 S510 N705 S510 N706 S510 N707 S510 N710 S510 N711 S510 N712 S510 N714 S510 N715 S511 N701 S511 N702 S511 N703 S511 N704 S511 N705 S511 N706 S511 N707 S511 N710 S511 N711 S511 N712 S511 N714 S511 N715 N701 N702 N703 N704 N705 N706 N707 N710 N711 N712 N714 N715 S502 S503 S505 S506 S507 S508 S510 S511 Table 4. Pipetting scheme for barcoding 96 samples using 8 i5 indexes (vertical) and 12 i7 indexes (horizontal). Using the 16 x 24 described indexes of Illumina it is also possible to unequivocally indentify up to 384 samples. Microsynth Competences and Services One of Microsynth’s core skills is in the field of amplicon deep sequencing. Microsynth is able to offer its customers a non-stop service covering the entire process from experimental design plan - ning, DNA isolation, PCR amplification and sequencing up to bioinformatics analysis of the generated data for typical deep sequencing projects (see Figure 2 ). DNA Isolation: Either the customer pro - vides isolated DNA or outsources this step to Microsynth (>13 years of experi - ence in DNA/RNA isolation from various and demanding matrices). PCR Amplification: The PCR amplifica - tion will use a state-of the-art high-fidel - ity polymerase resulting in high-quality multiplex amplicon libraries. The cus - tomer either provides the DNA, the first- step PCR products, or the second-step products. The advantage of providing the first-step PCR products is that you will only need two primers per locus and do not need to order any indexed primers. PCR products are purified, quantified with fluorescence spectroscopy and pooled in equimolar amounts. NGS Sequencing: Sequencing is done using Illumina MiSeq/NextSeq sequenc - ing technology. Both technologies allow high-throughput profiling at low costs, and the MiSeq has the additional advan - tage of long reads. Bioinformatics Analyses: Depending on customer requirements, Microsynth can offer customized analysis of the data including demultiplexing, QC of the sequence data, paired-end read merging, mapping and identification of InDels and SNVs and analysis of their like - lihood. For gene editing specific analy - sis (e.g. CRISPR/Cas), please also consult the gene editing application note. select your desired indexed forward and reverse primers. Send the upload sheet to info@microsynth.ch and request your specific offer. Alternatively, directly order the oligos in our webshop using the prefix “NGS_” in the 0.2 ?mol scale, HPLC purified. Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Figure 2. Typical steps in a amplicon deep-se - quencing project. Depending on researcher needs, Microsynth can deliver a one-stop service encom - passing DNA isolation, PCR amplification and sequencing, and customized data analysis. 010 2030 40 050 100 150 200 Distribution of Deletion s Size (bp) count 0 50 100 150 0500 1000 1500 Distribution of Mutation s Position (bp) count Alottment of Mutated Positions A: Sample 01 B: Sample 02 C: Sample 03 D: Sample 04 A B C D 9 3 3 8 0 1 9 4 9 3 24 2 2 0 2 Example Outputs for an Amplicon Deep-Sequencing Project A B C Figure 3. Example output of a deep-sequencing project. Sequencing reads of individual samples are aligned to the reference, and the distribution of SNPs (3A) and Indels (3B) are reported. In addition, Veen diagrams are displayed to visualize the number of mutations shared by the different samples included in the analysis (3C). Amplicon Deep Seq Analysis Project Output: Total DNA Isolation DNA Second Step PCR Illumina MiSeq (long), Illumina NextSeq (deep) Option I: Samples Option II: Isolated DNA Project Input: Report Generation Option IV: Bioinformatics only Experimental Design Option I: Library Prep only Option II: Raw Data only Option III: Full Report First Step PCR with Custom or Standard Primer Set Option III: First Step Products Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing